FOLLOW US: facebook twitter

Προτεινόμενες απαντήσεις θεμάτων στη Βιολογία Προσανατολισμού από το φροντιστήριο «Ανάλυση»

Ημερομηνία: 19-06-2019 | Συγγραφέας:
Κατηγορίες: Εκπαίδευση, Νέα

 ΘΕΜΑ Α

Α1.  → Α

Α2.  → Β

Α3.  → Γ

Α4.  → Γ

Α5.  → Β

 

 

ΘΕΜΑ Β

Β1. 1 – Ζ

2 – ΣΤ

3 – Α

4 – Ε

5 – Β

6 – Δ

 

Β2. Η  DNA πολυμεράση, παρόλο που αποτελεί το κύριο ένζυμο της αντιγραφής, δεν έχει την ικανότητα να αρχίσει την αντιγραφή, καθώς χρειάζεται ένα ελεύθερο  υδροξύλιο για να κάνει την επιμήκυνση των τμημάτων. Για το λόγο αυτό η αντιγραφή έχει προσανατολισμό 5’→ 3’.

Συνεπώς, στο μόριο Α θα πραγματοποιηθεί η σύνθεση του DNA καθώς υπάρχει ελεύθερο υδροξύλιο, σε αντίθεση με τα μόρια Β και Γ.

Συγκεκριμένα, στο μόριο Β δεν υπάρχει κάποιο πρωταρχικό τμήμα το οποίο να επιμηκύνει.

Στο μόριο Γ υπάρχει μεν τμήμα, ωστόσο το ελεύθερο άκρο διαθέτει φωσφορική ομάδα και όχι υδροξύλιο.

 

Β3. Α. Το άτομο είναι θηλυκό.

Β. Το άτομο πάσχει από σύνδρομο Turner.

Γ. Τα άτομα αυτά δεν εμφανίζουν δευτερογενή χαρακτηριστικά του φύλου, παρ’ όλο που έχουν φαινότυπο θηλυκού ατόμου, και είναι στείρα.

Δ. Απεικονίζονται 90 μόρια DNA, καθώς ο καρυότυπος απεικονίζει μεταφασικά χρωμοσώματα τα οποία είναι διπλασιασμένα.

 

Β4. Η γονιδιακή θεραπεία έχει ως στόχο να «διορθώσει» τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου.

 

Απαραίτητες προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας είναι:

1. Χαρτογράφηση του υπεύθυνου γονιδίου

2. Κλωνοποίηση του υπεύθυνου (φυσιολογικού) γονιδίου

3. Προσδιορισμός των κυττάρων που εμφανίζουν τη βλάβη από την ασθένεια

4. Το γονίδιο της ασθένειας να είναι υπολειπόμενο

 

ΘΕΜΑ Γ

Γ1. Παρατηρούμε ότι η αναλογία φύλου στους απογόνους είναι 2θηλυκά:1αρσενικό και ότι η έλλειψη της πρωτεΐνης δεν εμφανίζεται σαν χαρακτηριστικό στον πληθυσμό των απογόνων. Συνεπώς, το αλληλόμορφο για την έλλειψη της πρωτεΐνης είναι φυλοσύνδετο θνησιγόνο.

Ο θηλυκός γονέας είναι ετερόζυγος ώστε οι μισοί αρσενικοί απόγονοι να μην επιβιώνουν.

Συμβολισμός: ΧΑ : αλληλόμορφο υπεύθυνο για παραγωγή πρωτεΐνης

Χα : θνησιγόνο αλληλόμορφο

 

Όσον αφορά στο χρώμα του σώματος, η αναλογία είναι 1άσπρο:2κίτρινα:1μαύρο ανεξάρτητα από το φύλο. Συνεπώς τα αλληλόμορφα είναι αυτοσωμικά και μάλιστα πρόκειται για πολλαπλά αλληλόμορφα καθώς από τη διασταύρωση κίτρινου με μαύρου γονέα προκύπτουν και οι τρεις φαινότυποι.

Συμβολισμός: Κ1: αλληλόμορφο υπεύθυνο για το κίτρινο χρώμα

Κ2: αλληλόμορφο υπεύθυνο για το μαύρο χρώμα

Κ3: αλληλόμορφο υπεύθυνο για το άσπρο χρώμα, με σχέση Κ1> Κ2 > Κ3

 

Το θηλυκό άτομο έχει γονότυπο Κ1Κ3ΧΑΧα

Το αρσενικό άτομο έχει γονότυπο Κ2Κ3ΧΑY

 

Γ2. 1η  περίπτωση: Εάν το γονίδιο είναι αυτοσωμικό:

 

Ρ:             ΑΑ (x) αα

Γαμέτες: Α           α

F1   :                Αα

Φ.Α. : όλοι με μεγάλες κεραίες

 

2η  περίπτωση: Εάν το γονίδιο είναι φυλοσύνδετο:

 

Ρ:             ΧαΧα (x) ΧΑΥ

Γαμέτες:    Χα       ΧΑ, Υ

F1   :             ΧαΥ, ΧΑΧα

Φ.Α. : όλα τα θηλυκά με μεγάλες κεραίες, όλα τα αρσενικά με μικρές κεραίες

 

Γ2. Στην καλλιέργεια Α αναπτύσσονται όσα βακτήρια είναι μετασχηματισμένα, είτε έχουν προσλάβει ανασυνδυασμένο πλασμίδιο, είτε όχι (αποικίες 1, 2, 3, 4, 5, 6, 7). Αυτό συμβαίνει καθώς αυτά τα βακτήρια που έχουν προσλάβει πλασμίδιο εμφανίζουν ανθεκτικότητα στην αμπικιλίνη και επιβιώνουν παρουσία γλυκόζης ως πηγή άνθρακα.

Στην καλλιέργεια Β αναπτύσσονται μόνο όσα βακτήρια είναι μετασχηματισμένα χωρίς ανασυνδυασμένο πλασμίδιο (αποικίες 1, 2, 4, 6). Αυτό συμβαίνει γιατί όσα έχουν προσλάβει το ανασυνδυασμένο πλασμίδιο δεν επιβιώνουν παρουσία λακτόζης, αφού σε αυτά το οπερόνιο της λακτόζης είναι ανενεργό αφού σε αυτό, και συγκεκριμένα στο γονίδιο της β-γαλακτοζιδάσης έχει εισαχθεί το γονίδιο της πρωτεΐνης.

 

 

ΘΕΜΑ Δ

Δ1. Ο θηλυκός απόγονος φέρει μόνο μεταλλαγμένα αλληλόμορφα, ενώ ο αρσενικός απόγονος μόνο φυσιολογικά αλληλόμορφα.

 

1η περίπτωση: αυτοσωμικός υπολειπόμενος χαρακτήρας

 

Συμβολισμός: Α: φυσιολογικό αλληλόμορφο

α: μεταλλαγμένο αλληλόμορφο

 

Το άτομο Ι1 πρέπει να έχει γονότυπο αα, και το άτομο Ι2 Αα ή ΑΑ.

Η περίπτωση αυτή απορρίπτεται γιατί από αυτούς τους γονείς δεν μπορεί να προκύψει το άτομο ΙΙ2 που φέρει μόνο φυσιολογικά αλληλόμορφα.

 

2η περίπτωση: αυτοσωμικός επικρατής χαρακτήρας

 

Συμβολισμός: α: φυσιολογικό αλληλόμορφο

Α: μεταλλαγμένο αλληλόμορφο

 

Το άτομο Ι1 πρέπει να έχει γονότυπο Αα ή ΑΑ, και το άτομο Ι2 αα.

Η περίπτωση αυτή απορρίπτεται γιατί από αυτούς τους γονείς δεν μπορεί να προκύψει το άτομο ΙΙ21 που φέρει μόνο μεταλλαγμένα αλληλόμορφα.

 

3η περίπτωση: φυλοσύνδετος υπολειπόμενος χαρακτήρας

 

Συμβολισμός: ΧΑ: φυσιολογικό αλληλόμορφο

Χα: μεταλλαγμένο αλληλόμορφο

 

Το άτομο Ι1 πρέπει να έχει γονότυπο ΧαΥ, και το άτομο Ι2 ΧΑΧΑ ή ΧΑΧα.

Η περίπτωση αυτή είναι δεκτή, εάν ο θηλυκός γονέας είναι ετερόζυγος,  καθώς είναι δυνατόν να προκύψουν και  θηλυκοί απόγονοι που φέρουν μόνο μεταλλαγμένα αλληλόμορφα αλλά και αρσενικοί απόγονοι με φυσιολογικά μόνο αλληλόμορφα.

 

Δ2. Οι γονότυποι των παιδιών της οικογένειας είναι:

ΙΙ1 : ΧαXα

ΙΙ2: ΧΑΥ

Μόνο το άτομο ΙΙ1 θα εμφανίσει συμπτώματα.

 

Δ3. Από το άτομο Ι1 θα προκύψουν τμήματα DNA μήκους 600ζ.β. και 400ζ.β.

Ενώ από το άτομο ΙΙ1 θα προκύψουν τμήματα DNA μήκους 600ζ.β., 400ζ.β. και 1000 ζ.β.

 

Δ4. α.Η αλληλουχία της κωδικής αλυσίδας του μεταλλαγμένου αλληλόμορφου  είναι:

5’…CGAACGATGCCAGTCTCAATTCACGGA…3’

 

Β. Η μετάλλαξη αντικατάστασης μίας βάσης δημιούργησε στο γονίδιο θέση αναγνώρισης από την περιοριστική ενδονουκλεάση EcoRI. H EcoRI αναγνωρίζει την αλληλουχία 5’GAATTC3’ (και τη συμπληρωματική της) και κόβει μεταξύ G και Α με κατεύθυνση 5’ προς 3’.

Συνεπώς αντικαταστάθηκε η 17η  βάση από το 5’ άκρο με G. Η μετάλλαξη δημιουργεί κωδικόνιο λήξης 5’TGA3’ που οδηγεί σε πρόωρο τερματισμό της πρωτεϊνοσύνθεσης, γεγονός που οδηγεί σε απώλεια λειτουργικότητας της πρωτεΐνης.

Γκιουμέ Ιωάννα – Βιολόγος

Φροντιστήρια Μ.Ε. ¨Ανάλυση – Εξέλιξη¨

Αφήστε μια απάντηση

Η ηλ. διεύθυνση σας δεν δημοσιεύεται. Τα υποχρεωτικά πεδία σημειώνονται με *

Generic selectors
Exact matches only
Search in title
Search in content
Search in posts
Search in pages

ΤΟ ΠΡΩΤΟΣΕΛΙΔΟ

agro-stathmos-georgika-farmaka-viologika skeuasmata-ad
image description
Proini_04-12-2017_olga:Layout 1.qxd
ydrotherm-ad2
ellinika-petrelaia-ad2
anthoulis-xaralampos-courier-ad1
iliagora-epimelitirio-ad2
image description

ΕΙΔΙΚΕΣ ΕΚΔΟΣΕΙΣ

Πρωινή Πρωτοσέλιδα Εφημερίδων